BIOL 1400 -- Lecture Outline 25

"You cannot reshape human nature without mutilating human beings." -- Edward Abbey

I. A swift look at cancer. . .

  1. Cancer is fundamentally a disease in which a population of cells cannot stop dividing. Often the dividing cells form a lump, or tumor; some cancers, such as leukemia, do not form tumors.
    1. Tumors may be benign (relatively harmless) or malignant (harmful). Technically, only a malignant tumor is a cancer; benign tumors (such as warts) aren't considered cancer.
    2. Malignant tumors cause severe damage to the surrounding tissues in which they grow. Benign tumors don't damage the surrounding tissues, although both types may block key blood vessels and nerves.
    3. Malignant tumors also undergo metastasis -- small clumps of cells break off the larger tumor, are transported to other parts of the body, and form new tumors. Over 90% of people who die from cancer die because of metastasis.
    4. Tumors also consume large amounts of the body's energy resources -- large tumors can actually cause blood vessels to grow into them and supply them with oxygen and nutrients. Persons with cancer may become easily tired and lose weight rapidly.
  2. But what causes cancer?
    1. The key insight here is simple: Some genes modify the effect of other genes.
      1. The simplest way that this happens is this: one gene may make a protein that binds to another part of the DNA and either promotes or blocks the transcription of another gene.
    2. Certain genes, called oncogenes, act to promote cell division.
      1. You can think of the proteins that oncogenes make as being like "antennas" -- when cells are stimulated to divide, the oncogene proteins activate many other genes in the cell and cause the cell to prepare for division.
      2. A damaged oncogene may cause a cell to divide rapidly -- like a car with a stuck accelerator pedal.
    3. Other genes, tumor suppressor genes, act to repress cell division. There are several of these -- but one tumor suppressor gene, called p53, is implicated in 60% of human cancers.
      1. When the tumor suppressor genes are "on" -- i.e., when they're being transcribed and translated -- they produce proteins that block cell division from happening.
      2. If these genes are damaged, a cell may divide repeatedly -- as rapidly and uncontrollably as a car with no brakes rolling downhill.
    4. Normal cells are limited in the number of times that they can divide.
      1. The tips of each chromosome are known as telomeres -- these are stretches of DNA that don't code for proteins.
      2. Each telomere consists of the sequence
        TTAGGG
        AATCCC
        repeated up to 2000 times:
        . . . TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG. . . .
        . . . AATCCCAATCCCAATCCCAATCCCAATCCCAATCCC
        .
      3. Telomeres function in keeping chromosomes form accidentally sticking together at the tips. . .
      4. . . . and at every cell division, about 100 nucleotides are lost from the telomeres of each chromosome. The telomeres thus act like a "clock" or "hourglass"; the more times a cell has divided, the shorter the telomeres.
      5. When the telomeres are gone, a cell can no longer divide. Normal human cells from an infant can be raised in a dish, but they can't divide more than about 70 times.
      6. Some cell types can regrow their telomeres, thanks to an enzyme called telomerase. The cells that become eggs and sperm, for instance, can do this, and so can single-celled eukaryotes. . .
      7. Cancer cells are also able to regrow new telomeres, and thus can divide indefinitely. We say that cancer cells are "immortalized" -- cells from the cervical cancer of a woman named Henrietta Lacks have been grown in laboratories since 1951, dividing once every 24 hours, and they show no sign of stopping!
      Finally, normal cells have the capability to undergo a kind of orderly, preprogrammed self-destruction called apoptosis.
      1. A cell undergoing apoptosis breaks down its chromosomes and fragments into many tiny blobs.


        A single cell (about 10 microns in diameter) seen with the scanning electron microscope, undergoing apoptosis. Notice how it's breaking up into tiny lumps. In a living organism, these lumps would be engulfed and digested by surrounding cells.

      2. Damaged or virus-infected cells may undergo apoptosis, as part of the body's normal "maintenance" and defense mechanisms.
      3. Normal cells also undergo apoptosis in many circumstances -- the cells lining your large intestine, for example, are constantly dying through apoptosis and being replaced with new cells.
      4. Apoptosis is also important in embryological development -- for example, your hand developed from a paddle-like structure. The reason that you have freely movable, separate fingers is that the cells that used to form the "webbing" between them all committed apoptosis.
      5. Tumor cells often have lost the ability to undergo apoptosis.
  3. Anything that can damage DNA and cause mutations can cause cancer, or at least contribute to it.
    1. Usually, cancer cells show some sort of chromosomal abnormalities: missing or duplicate chromosomes, deletions of part of one or duplications of part of one, Inversions (part of a chromosome is reversed), and so on.
    2. DNA-damaging agents should sound familiar: ultraviolet (UV) light, radioactivity, X-rays and other forms of radiation, and certain chemicals known as carcinogens all damage DNA -- and all are linked to cancers.
    3. As part of the natural metabolism of cells, substances called oxidants are produced that can damage DNA. Hence the buzz in the media about vitamins and other supplements that act as anti-oxidants -- they may protect you from cancer by blocking DNA damage by oxidants.
    4. Some cancers result because the cell's ability to repair its own DNA is weakened -- e.g. by a faulty gene for a DNA repair enzyme.
      1. EXAMPLE: A very rare disease called xeroderma pigmentosum (XP) results when skin cells lack the ability to repair DNA damage from sunlight. XP sufferers have a greatly increased risk of skin cancer and must stay out of direct sunlight.
    5. Viruses, which can mess with a cell's DNA by injecting their own DNA, have been linked to certain types of cancer.
      1. EXAMPLE: Human papilloma virus, or HPV, causes genital warts -- but some types of HPV increase the risk of cervical cancer in infected women (4,400 U.S. women die of cervical cancer each year, almost all due to HPV infection -- more information here.)
      2. EXAMPLE: Hepatitis B virus infection in the liver greatly increases the risk of liver cancer.
    6. Some types of cancer (not all!) run in families, since defective oncogenes, tumor suppressor genes, etc. can all be inherited.
      1. Some forms of breast, eye and colon cancers are caused, at least in part, by inherited faulty genes.
      2. Familial cancers may affect children and young adults more frequently than other forms of cancer.
    7. Anything that increases the number of times that cells divide also increases the risk of cancer, simply because each time a cell divides there is a risk of a mutation in a cancer-related gene -- the more divisions, the greater the risk.
      1. Simply living a long time increases the number of times that cells divide. . . and thus it increases the chance that one of those cells will become cancerous. This is why cancer is most common in older people: 70% of all cancers are diagnosed in people aged 60 or older.
      2. Alcohol use, by itself, doesn't greatly increase the risk of throat cancer, but alcohol and tobacco use together create a higher risk of throat cancer than either one does alone. . .
        1. Why? Drinking alcohol irritates the throat, and causes increased die-off of the epithelial cells lining the throat. . . and increased rates of cell division to replace the damaged epithelial cells.
        2. This gives the carcinogens in alcohol and tobacco more "opportunities" to cause a mutation that will lead to cancer. . .
      3. Why is breast cancer on the increase?
        1. Part of the reason seems to be this: With every menstrual cycle, cells in the breast divide, as the breast prepares for possible pregnancy and lactation (production of milk).
        2. Because of better nutrition, women are beginning menstruation at a younger average age, and ending it at an older age.
        3. Also, pregnancy and lactation suppress menstruation -- but in industrial societies, women are having fewer children, and not breast-feeding them as often or for as long as was once common.
        4. More menstrual cycles = more frequent cell division in the breast = increased breast cancer risk
    8. How can we know whether something causes cancer?
      1. The most obvious way is to administer it to experimental animals such as mice. . . but this is expensive and time-consuming (and also intensely annoying to people who don't believe in animal testing.)
      2. The Ames test involves treating certain bacteria with a potential carcinogen and counting the number of mutations.
        1. Why does this work? Remember that DNA is fundamentally alike in all living things. The idea is that whatever damages bacterial DNA can damage human DNA, too.
        2. A criticism is that the Ames test misses some chemicals that are known to cause cancer (such as the artificial sweetener saccharine) and identifies many chemicals that are practically harmless as cancer-causing. . .
        3. The Ames test isn't a final, conclusive test, but it can identify chemicals that should be studied further.

    Go to Previous Notes | Return to Lecture Schedule | Return to Syllabus | Contact the Prof | Go to Next Notes